Aloe Emodin Synthesis Essay

Abstract

Background/Aims: High-fat diet (HFD) causes cardiac electrical remodeling and increases the risk of ventricular arrhythmias. Aloe-emodin (AE) is an anthraquinone component isolated from rhubarb and has a similar chemical structure with emodin. The protective effect of emodin against cardiac diseases has been reported in the literature. However, the cardioprotective property of AE is still unknown. The present study investigated the effect of AE on HFD-induced QT prolongation in rats. Methods: Adult male Wistar rats were randomly divided into three groups: control, HFD, and AE-treatment groups. Normal diet was given to rats in the control group, high-fat diet was given to rats in HFD and AE-treatment groups for a total of 10 weeks. First, HFD rats and AE-treatment rats were fed with high-fat diet for 4 weeks to establish the HFD model. Serum total cholesterol and triglyceride levels were measured to validate the HFD model. Afterward, AE-treatment rats were intragastrically administered with 100 mg/kg AE each day for 6 weeks. Electrocardiogram monitoring and whole-cell patch-clamp technique were applied to examine cardiac electrical activity, action potential and inward rectifier K+ current (IK1), respectively. Neonatal rat ventricular myocytes (NRVMs) were subjected to cholesterol and/or AE. Protein expression of Kir2.1 was detected by Western blot and miR-1 level was examined by real-time PCR in vivo and in vitro, respectively. Results:In vivo, AE significantly shortened the QT interval, action potential duration at 90% repolarization (APD90) and resting membrane potential (RMP), which were markedly elongated by HFD. AE increased IK1 current and Kir2.1 protein expression which were reduced in HFD rats. Furthermore, AE significantly inhibited pro-arrhythmic miR-1 in the hearts of HFD rats. In vitro, AE decreased miR-1 expression levels resulting in an increase of Kir2.1 protein levels in cholesterol-enriched NRVMs. Conclusions: AE prevents HFD-induced QT prolongation by repressing miR-1 and upregulating its target Kir2.1. These findings suggest a novel pharmacological role of AE in HFD-induced cardiac electrical remodeling.

© 2017 The Author(s). Published by S. Karger AG, Basel


Introduction

Hyperlipidemia and other life-style related diseases, are characterized by the metabolic disorder of blood lipids and cholesterol [1]. Numerous studies have found that metabolic disorder is an important risk factor for cardiovascular diseases, such as atherosclerosis, coronary artery disease, and even sudden cardiac death [2]. Epidemiological studies have suggested that high-fat diet (HFD) contributes to hyperlipidemia and obesity [3]. Hypercholesterolemia induced pro-arrhythmic neural and electrophysiological remodeling was associated with prolonged action potential duration, longer QTc intervals, increased repolarization dispersion, and increased ventricular vulnerability to fibrillation [4]. Some experimental and clinical studies have shown that HFD is related to QT prolongation, atrial fibrillation [5, 6]. However, underlying mechanisms are not fully understood, and better therapeutic measurements are urgently needed.

Recently, the use of traditional Chinese medicine has been gaining increasing attention. For instance, the pervasive effects of Tanshinone and Berberin in the prevention and cure of common cardiovascular diseases has been clarified [7, 8]. In the current study, Aloe-emodin (Fig. 1A) is a monomer of phenanthrenequinones extracted from rhubarb and has a similar chemical structure with emodin [9]. Several studies have reported the protective effect of emodin against cardiac diseases. For example, Feng et al. demonstrated the protective effect of emodin against metabolic disorders by selectively inhibiting 11beta-hydroxysteroid dehydrogenase type 1 in diet-induced obese mice [10]. In addition, another study also found that emodin treatment can ameliorate hypercholesterolemia by binding with sodium deoxycholate [11]. Until now, various pharmacological effects of AE including anti-neoplasticity [12], anti-inflammation [13], and strengthening of immunity [14], have been elucidated. However, the potential role of AE in the cardiovascular system is limited. Thus, the present study focused on the relationship between AE and HFD-induced cardiac dysfunction.

Fig. 1.

Chemical structure of AE and effects of high-fat diet (HFD) on serum lipids. (A) Chemical structure of AE. (B) Serum total cholesterol (TC) level. (C) Serum triglyceride (TG) level. Data are shown as mean ± SD, t-test analysis of variance (ANOVA). * P < 0.05, *** P < 0.001, versus Control. n=10 rats in the control group, n=20 rats in the HFD group.

MicroRNAs (miRNA, miR) are a group of endogenous non-coding RNA, approximately 22 nucleotides in length, which play important roles in post-transcriptional gene regulation [15]. Numerous studies suggest that miRNAs are implicated in the development of cardiovascular diseases [16, 17]. Among them, many studies have demonstrated that miR-1 plays a critical role in the occurrence of both ventricular and atrial arrhythmias by post-transcriptionally modulating ion channels and proteins related to cardiac electrical activity [18-20]. Based on these findings, the present study was conducted to investigate the two aspects. The first aim is to explore the effect of AE on HFD-induced QT prolongation. The second aim is to decipher the molecular mechanism of AE by regulating miR-1 and related ion channels. The current study enhances the understanding on the pharmacological role of AE, which may be useful for further development of novel anti-arrhythmic drug.

Materials and Methods

Animals

Animals were obtained from the Experimental Animal Center of Harbin Medical University and were maintained at a temperature of 22°C–24°C with a 12 h light-dark cycle. All of the animal experiments were conducted according to the Ethics Committee of Harbin Medical University, and the use of animals complied with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (8th Edition, 2011). Male Wistar rats weighing 180-220 g (two months old) were randomly divided into control, HFD, and AE-treatment groups. Normal diet was given to rats in the control group, and high-fat diet was given to rats in the HFD and AE groups for a total of 10 weeks. First, HFD rats and AE-treatment rats were fed with high-fat diet for 4 weeks to establish the HFD model. Serum total cholesterol (TC) and triglyceride (TG) were detected to validate HFD model. Then, 100 mg/kg AE (98% purity, Tianfeng Biotechnology Co., Ltd., Xian, China) was dissolved in water and intragastrically administered daily for another 6 weeks.

Diets

Conventional food was obtained from the Animal Center of the Second Affiliated Hospital of Harbin Medical University. High-fat food comprises 10% lard, 10% egg yolk powder, 2% cholesterol, 0.2% bile salts, 0.2% methyl oxygen pyrimidine, and 77.6% basal feed. High-fat food was provided by HuaFuKang Biotechnology Co., Ltd. (Beijing, China).

Neonatal rat ventricular myocytes culture

The procedures for culturing neonatal rat ventricular myocytes (NRVMs) were according to previous work [21]. Briefly, the hearts of neonatal Wistar rats were rapidly removed, minced in serum-free Dulbecco’s Modified Eagle Media (DMEM, HyClone, Logan, UT), and then digested in 0.25% trypsin solution. Dispersed cells were suspended in DMEM containing 10% fetal bovine serum and then centrifuged. The isolated cells were plated onto dishes at a density of 105 cells·cm-2. Then, 0.1 mM bromodeoxyuridine was added into the medium to deplete nonmyocytes. Cardiomyocytes were cultured under a condition of 5% CO2 at 37 °C. Cardiomyocytes were starved in serum-free medium for 24 h, and then transiently transfected with miR-1 (50 nM), miR-1 inhibitor (100 nM), or negative control (NC), using X-treme GENE siRNA transfection reagent (Roche, USA) according to the manufacturer’s instructions. MiR-1 mimic (5′-UGGAAUGUAAAGAAGUGU GUAU-3′), miR-1 inhibitor (5′-ATACACACTTCTTTTACATTCCA-3′), and NC were synthesized by Guangzhou RiboBio (Guangzhou, China). Twenty four hours after transfection, cholesterol was prepared in ethanol and added into the medium at 10 μg/ mL for 6 h. Cholesterol model was employed in vitro to mimic high-fat in vivo. After that, AE was prepared in DMSO and added into the medium at 90 μM for 24 h. The final concentration of ethanol or DMSO was less than 0.1%. In protocol 1, cells were randomly divided into control, cholesterol, cholesterol+miR-1 inhibitor, and cholesterol+NC groups. In protocol 2, cells were randomly divided into control, cholesterol, cholesterol+AE, cholesterol+AE+miR-1 mimic, cholesterol+AE+NC, and AE alone groups, respectively.

Measurement of serum lipid indexes

Blood samples (0.5-1 ml) were collected from the tail vein after high-fat diet for four weeks. The blood samples were placed on ice after 30 min and then centrifuged at 3, 000 rpm for 10 min at 4 °C. Supernatants were extracted according to the kit instructions (Jiancheng Bioengineering Institute, Nanjing, China). Serum TC and TG contents were determined at 500 nm with an Infinite M200 microplate reader (Tecan, Salzburg, Austria).

Electrocardiogram analysis

Standard lead II electrocardiogram (ECG) was monitored using a BL-420F bio-functional experiment system (TME Technology Co., Ltd., Chengdu, China) after the rats were administrated AE for 0, 2, 4, and 6 weeks, respectively. Adult rats were anesthetized by intraperitoneal injection of sodium pentobarbital (40 mg/kg). The pedal withdrawal reflex (assessed by pinching the tail and the metacarpal region of the hind foot between the index finger and the thumb) was tested to assess the depth of anesthesia [22]. ECG recording was performed for 15 min every time. Six recordings were made for each group. The ECG waveforms averaged over five consecutive beats were used for analyses. The heart rate, PR interval, QRS duration and QT interval were measured from the ECG. The heart rate-corrected QT interval (QTc) was calculated by the Bazett formula: QTc = QT/(RR/150)1/2, which was adjusted for rats [23]. The end of the T-wave was identified as the point at which the slow component of the biphasic T-wave returned to the isoelectric line. Five QRS complexes were analyzed for each rat. The surviving animals were then sacrificed, and the hearts were quickly excised, and used for the subsequent experiments.

Isolation of ventricular myocytes

The procedure for cardiomyocyte dissociation was described in a previous work [24]. Rat ventricular myocytes were briefly isolated by enzymatic dissociation. Rats were anaesthetized with sodium pentobarbital (40 mg/kg, ip). The hearts were excised rapidly and perfused through the aorta using Langendorff method for 5 min with Ca2+-free Tyrode’s solution containing (in mM): NaCl 136.0, KCl 5.4, MgCl2 1.0, NaH2PO4 0.33, glucose 10.0, and HEPES 10.0 (pH adjusted to 7.4 with NaOH). The hearts were then digested with Ca2+-free Tyrode’s solution containing 0.2 mg/mL collagenase II (Worthington Biochemicals, Lakewood, NJ, USA) and 0.2 mg/mL bovine serum albumin (Gibco-BRL, Grand Island, NY, USA) for another 30-50 min. All of the solutions were oxygenated and warmed at 37 °C during perfusion. Single cardiomyocytes were stored in Kraftbruhe solution containing (in mM): glutamic acid 70.0, taurine 15.0, KCl 30.0, HEPES 10.0, KH2PO4 10.0, MgCl2 0.5, glucose 10, and EGTA 0.5 (pH adjusted to 7.4 with KOH). Single cell was obtained by gentle pipetting and stored at 4°C for 1 h before patch-clamp recording. Only rod-shaped and clear- texture cardiomyocytes were selected for further studies.

Whole-cell patch-clamp technique

Whole-cell patch-clamp technique was used to record the action potential (AP) and the inward rectifier K+ current (IK1) with an AxopatchTM 200B amplifier and analyzed using pCLAMP 10.0 software (Axon Instruments, Inc., Foster City, CA, USA). Cardiomyocytes were placed in the chamber at room temperature with Ca2+-containing Tyrode’s solution containing (mM): NaCl 136, KCl 5.4, MgCl2·6H2O 1, NaH2PO4.2H2O 0.33, CaCl2 1.8, HEPES 10, and glucose 10 (pH adjusted to 7.4 with NaOH). Borosilicate glass electrodes with a tip resistance of 2-4 MΩ were used and filled with the pipette solution containing (in mM): KCl 20, Kaspartate 110, MgCl2 1, HEPES 5, EGTA 10, and Na2ATP 5 (pH adjusted to 7.2 with KOH). AP and IK1 were recorded by the current-clamp and voltage-clamp mode, respectively. IK1 was stimulated by using a holding potential of -40 mV and 300 ms pulses ranging from –120 mV to +50 mV with an increment of 10 mV.

Western blot analysis

Total protein samples were extracted from rat ventricular tissues or NRVMs as in previous studies [25]. Protein samples (∼70 μg) were fractionated by SDS-PAGE (10% polyacrylamide gels) and transferred to nitrocellulose membrane. The membranes were suspended in 5% non-fat milk at room temperature for 2 h.Themembranes were then incubated at 4°C overnight with the primary antibodies as follows: anti-Kir2.1, anti-Kv4.2, anti-Kv4.3 (1: 200, Alomone Labs, Jerusalem, Israel), anti-Cx43 (1: 500, Proteintech Group, Chicago, IL, USA), and anti-GAPDH (1: 1, 000, Kangcheng, Shanghai, China). The membranes were then washed thrice for 10 min each time with PBS-T, and incubated with secondary antibody for 1 h. Western blot bands were quantified by Odyssey CLx v2.1 software (LI-COR Biosciences, Lincoln, NE, USA).

Real-time PCR analysis

Total RNA samples from rat ventricles or NRVMs were extracted using TRIZOL reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA concentration was assessed using the NanoDropTM 8000 spectrophotometer (Thermo Scientific, France). cDNA was synthesized using a reverse transcription kit (Roche, USA). Quantitative real-time PCR was performed using SYBR Green PCR Master Mix on Light Cycler 480 RT-PCR system (Roche, USA). The sequences of primers were: miR-1 RT: GTCGTATCCAGTGCACC-GAGGTATTCGCACTGGATACGACATACAC; forward: 5′-GCGGCGGTGGAATGTAAAGAAG-3′ and reverse: 5′-ATC-CAGTGCAGGGTCCGAGG-3′; U6 RT: CGCTTCACGAATTTGCGTGTCAT; forward: 5′-GCTTCGGCACATATACTA-AAAT-3′ and reverse: 5′-CGCTTCACGAATTTGCGTGTCAT-3′. MiR-1 levels were quantified with the 2-ΔΔCt relative quantification method that was normalized to U6.

Data analysis

All of the data were presented as mean ± SD. Two group comparisons were performed by t-test. Oneway analysis of variance followed by Tukey’s test was used for multiple comparisons. A two-tailed P < 0.05 indicated a statistically significant difference. Data were analyzed with GraphPad Prism 5.0.

Results

Effects of HFD on serum lipids

We validated HFD model successfully that serum levels of TC and TG were significantly increased in the group of rats fed with HFD (n=20) compared with control group (n=10). (Fig. 1B and C). Our results also showed that the body weight and the ratio of heart weight to body weight (HW/BW) were not changed in HFD rats compared with those in the control group, and were not changed after administration of AE for 6 weeks as compared with HFD rats (Fig. 2A and B).

Fig. 2.

Comparisons of body weight and HW/BW of different groups. (A) Comparisons of body weight. (B) Comparisons of HW/BW. HW/BW: the ratio of heart weight to body weight. Data are shown as mean ± SD, one-way ANOVA. n = 5 rats/group.

Effect of AE on ECG in FD rats

To explore the role of AE on the regulation of cardiac arrhythmia and electrophysiology, we set up an experimental model with AE-treatment in HFD rats. ECG was ecorded after AE was administered for 0, 2, 4, and 6 weeks, respectively (Fig. 3A). The heart rate, PR interval, QRS duration, QT interval, and QTc were measured and calculated from the ECG (Fig. 3B to F). The heart rate was significantly slower with QT interval and QTc prolongation in HFD group as compared with that in the control group (Fig. 3B, E, and F), which were recovered after administration of AE for 6 weeks but not recovered after administration of AE for 0, 2, and 4 weeks. Clearly, AE-treatment for 6 weeks markedly shortened QTc (69.67 ± 4.56 ms), which was significantly prolonged by HFD (85.40 ± 14.62 ms) compared with that in the control group (68.37 ± 5.63 ms, Fig. 2F). No significant difference of PR interval and QRS duration were examined among these groups (Fig. 3C and D). These results indicated that AE prevented QTc prolongation induced by HFD.

Fig. 3.

Effect of AE on ECG in HFD rats. (A) Representative traces of the ECG of rats after administration of AE for 0, 2, 4, and 6 weeks, respectively. (B) Heart rate. (C) PR interval. (D) QRS duration. (E) QT interval. (F) Heart rate-corrected QT interval (QTc). Data are shown as mean ± SD, one-way ANOVA. * P < 0.05, ** P < 0.01, *** P < 0.001, versus Control; # P < 0.05, versus HFD, n = 6 rats/group.

Effect of AE on APD in ventricular cardiomyocytes of HFD rats

To confirm the effect of AE on cardiac electrical activity, we recorded the single-cell AP and compared the action potential duration (APD) by whole-cell patch-clamp in ventricular cardiomyocytes isolated from three different groups of rats (Fig. 4A). HFD markedly prolonged the action potential duration at 90% repolarization (APD90, 149.20 ± 29.82 ms), compared with that in the control group (92.71 ± 19.19 ms, P < 0.001). AE markedly shortened the APD90 (105.80 ± 26.22 ms), compared with that in the HFD group (P < 0.01, Fig. 4B). In addition, the RMP of cardiac myocytes in the HFD group were significantly depolarized (–77.96 ± 8.64 mV), compared with that in the control group (–64.81 ± 6.42 mV, P < 0.01), which was recovered by AE (–73.72 ± 6.25 mV, Fig. 4C). These results indicated that AE could reverse the adverse electrophysiological changes manifested by abnormal APD prolongation and membrane depolarization in the HFD condition.

Fig. 4.

Effect of AE on APD in ventricular cardiomyocytes of HFD rats. (A) Representative traces of action potential. (B) APD90 of cardiomyocytes. (C) RMP of cardiomyocytes. Data are shown as mean ± SD, one-way ANOVA. ** P < 0.01, *** P <0.001, versus Control; # P < 0.05, ## P <0.01, versus HFD, n = 8 cells from 5 rats/group.

Effect of AE on IK1 in ventricular cardiomyocytes of HFD rats

IK1 plays an important role in the maintenance of RMP and is involved in the third period of action potential repolarization. Except for APD prolongation, HFD also depolarized RMP, suggesting that the current density of IK1 was down-regulated by HFD. Our results showed that IK1 current was significantly decreased in HFD rats (Fig. 5A and B). The current density of IK1 was significantly decreased from –18.99 ± 1.53 pA/pF of the control group to –30.78 ± 2.35 of the HFD group, whereas the AE-treatment group reverted to –25.16 ± 0.97 pA/pF (Fig. 5C).

Fig. 5.

Effect of AE on IK1 in ventricular cardiomyocytes of HFD rats. (A) Voltage protocol and representative current traces. (B) Averaged current density-voltage (I-V) relationships of IK1. (C) Current densities of IK1 at a stimulus voltage of -120 mV. Data are shown as mean ± SD, one-way analysis of variance. *** P < 0.001, versus Control; ## P < 0.01, versus HFD, n = 8 cells from 5 rats/group.

Effect of AE on Kir2.1 protein expression in the hearts of HFD rats

As the above mentioned results indicated, the IK1 densities increased as an ionic mechanism underlying the effect of AE to prevent or correct the HFD-induced QTc and APD prolongation. We inferred that AE might act by upregulating the expression of the genes encoding the ion channel protein of IK1. Kir2.1 is the main K+ channel subunit that mediates IK1. Kir2.1 protein expression was detected by Western blot. Results showed that the protein expression of Kir2.1 in the HFD group was significantly decreased, as compared with that in the control group (P < 0.001). AE recovered Kir2.1 expression to normal levels (Fig. 6A). On the other hand, transient outward K+ current (Ito), is known to be responsible for the initial phase of cardiac repolarization [26]. Ito is a current flowing through the K+ channels composed of Kv4.2 and Kv4.3 as the main pore-forming α-subunits. A similar pattern of difference in Kv4.2 protein level was consistently observed in the HFD group but not in the AE group. The Kv4.3 protein level was not changed in the HFD and AE-treatment groups (Fig. 7A and B).

Fig. 6.

Effects of AE on the expression of Kir2.1 protein and level of miR-1 in the hearts of HFD rats. (A) Relative level of Kir2.1 protein. n = 6 rats/group. (B) Relative level of miR-1. n = 6 rats/group. (C) Relative level of CX43 protein. n = 5 rats/group. Data are shown as mean ± SD, one-way ANOVA. ** P < 0.01, *** P < 0.001, versus Control; ## P < 0.01, ### P < 0.001,versus HFD.

Fig. 7.

Comparisons of the expressions of Kv4.2 and Kv4.3 proteins in the hearts of rats in different groups. (A) Relative level of Kv4.2 protein. n = 5 rats/group. (B) Relative level of Kv4.3 protein. n = 4 rats/group. Data are shown as mean ± SD, one-way ANOVA. ** P < 0.01, versus Control.

Effect of AE on the miR-1 level in the hearts of HFD rats

The inward rectifier potassium channel subunit Kir2.1 is encoded by the KCNJ2 gene, which is a target of miR-1. To verify the involvement of miRNAs in the regulation of Kir2.1 expression by AE, we further measured the level of miR-1 in this study. It was found that the level of miR-1 was increased (∼2.73-fold) in the hearts of HFD rat hearts as compared with that in the control group (Fig. 6B). Overexpression of miR-1 was reversed by AE. A validated and established target for miR-1 is also connexion 43. The connexion 43 protein level was down-regulated in HFD rats, but was not reversed by AE (Fig. 6C). Taken together, the results generally suggested that the expression of Kir2.1 protein was inhibited by the overexpression of miR-1 and AE may down-regulate the overexpression of miR-1 induced by long-term HFD, therefore recovering the decreased level of Kir2.1 protein in HFD rats.

Effects of AE on regulation of the level of miR-1 and Kir2.1 in vitro

To examine the effects of AE on cardiomyocytes suffering from HFD, NRVMs were cultured and subjected to cholesterol-enrichment to simulate HFD in vitro. Consistently, we found that the miR-1 level was significantly higher with lower expression of Kir2.1 protein in cholesterol cells than in control cells. This alteration was markedly reversed by miR-1 inhibitor (Fig. 8A and B). Furthermore, the down-regulation of miR-1 and up-regulation of the Kir2.1 protein in cholesterol+AE cells were restored by miR-1 mimic (Fig. 8C and D). These results strongly supported that AE prevented the downregulation of Kir2.1 by repressing miR-1 in the HFD condition.

Fig. 8.

Effects of AE on miR-1 and Kir2.1 on cholesterol-enriching neonatal rat ventricular myocytes (NRVMs). (A) Effect of cholesterol on miR-1 in NRVMs. n = 5 batches of cells. (B) Effect of cholesterol on Kir2.1 in NRVMs. n = 5 batches of cells. (C) Effect of AE on miR-1 in cholesterol-enriching NRVMs. n = 4 batches of cells. (D) Effect of AE on Kir2.1 in cholesterol-enriching NRVMs. n = 4 batches of cells. Data are shown as mean ± SD, one-way ANOVA. *P < 0.05, versus Control; #P < 0.05, ## P < 0.01, versus Cholesterol; ^P < 0.05, ^^^P < 0.001, versus Cholesterol+AE.

Discussion

In this study, we examined QT-prolongation in HFD rats. To the best of our knowledge, we are the first to find that AE significantly inhibited HFD-induced QT-prolongation by repressing miR-1 and restoring IK1/Kir2.1. Overall, our findings uncover a novel cardioprotective effect of AE against QT-prolongation.

A number of previous studies have indicated that emodin has a promising protective effect against several cardiac diseases. For example, Wu et al. found that emodin protected against diabetic cardiomyopathy by modulating Akt/GSK-3β cascade in rats [27]. Emodin also inhibited acute cardiac ischemic injury through mitigation of local inflammation and apoptosis in mice [28]. Furthermore, emodin has hypoglycaemic and hypolipidaemic effects on dyslipidaemic-diabetic rats by upregulating L-type calcium channels in the pancreas and hearts [29]. By contrast, although the chemical structure of AE is similar to emodin, whether the application of AE has a cardioprotective effect is unknown. Accordingly, the current study was conducted to investigate the potential beneficial role of AE in HFD-induced QT-prolongation.

Previous studies have revealed that HFD promoted arrhythmic death and increased myocardial ischemia-reperfusion injury in rats [30]. Moreover, other studies also detected increased vulnerability of atrial arrhythmia and impaired conduction velocity in HFD mice [31]. Consistently, the current study found that HFD for 4 weeks caused a dysfunction in cardiac electrophysiology and increased QT-interval. Thus, the present study mainly focused on the relationship between AE and HFD-induced ventricular arrhythmias. Based on ECG recordings and patch-clamp data, our study demonstrated that AE significantly relieved HFD-induced QT prolongation by regulating inward rectifier potassium channel (IK1).

Increasing evidences support that intracellular lipid content can regulate ion channels. In this study, we found that IK1 current and Kir2.1 expression was decreased in HFD rats. The electrical activity of the heart is an extraordinary arrangement by multiple categories of ion channels, and the movement of ions across the cytoplasmic membrane of cardiomyocytes is controlled by transmembrane proteins [32]. The membrane potential and the rate of membrane repolarization are managed by potassium (K+) channels [33]. Among these channels, IK1 is a strong inward rectifier K+-selective current, which plays important roles in modulating the RMP and the final repolarization phase of action potential in cardiomyocytes [34]. IK1 also plays an important role in ventricular arrhythmias, highlighted by the Andersen-Tawil syndrome, associated with QT interval prolongation, and also mentioned as the LQT7, a form of the LQT syndrome [35, 36]. Down-regulation of IK1 may induce RMP depolarization and APD prolongation, resulting in QT prolongation. As a result of depolarization, the conductibility and automaticity of cardiomyocytes were inhibited, whereas the excitability of cardiomyocytes was increased. The dysfunction of IK1 in the hearts of HFD rats was caused by down-regulation of the protein expression of Kir2.1, which was the pore-forming subunit of the potassium channel to carry IK1 [37]. AE recovered the protein expression of Kir2.1. This result was in line with the QT interval shortening role of AE.

miR-1 is known to play an essential role in ventricular arrhythmias [38]. The IK1 subunit Kir2.1 (encoded by KCNJ2 gene) is a validated target of miR-1. In addition, previous studies have demonstrated that several agents, such as propranolol and Tanshinone effectively inhibited miR-1 expression to prevent ventricular arrhythmias [39, 40]. Lu et al. revealed that the beta-adrenoceptor-cAMP- PKA signaling pathway contributed to miR-1 expression, and serum response factor (SRF), which is known as one of the transcriptional enhancers of miR-1. Moreover, propranolol inhibited the beta-adrenoceptor–cAMP–PKA signaling pathway and suppressed SRF expression and partially produced beneficial effects by down-regulating miR-1 [39]. Moreover, Shan et al. found that down-regulation of miR-1 and consequent recovery of Kir2.1 may partially account for the efficacy of Tanshinone IIA in suppressing ischemic arrhythmias and cardiac mortality [40]. Furthermore, Tanshinone IIA could inhibit miR-1 expression by inhibiting activated p38 MAPK and heart special transcription factors, SRF and MEF2, in ischemic and hypoxic cardiomyocytes [41]. Therefore, miR-1 was a key molecule in the development of ventricular arrhythmias, which was emphasized in the current study. Our results showed that both AE could down-regulate the level of miR-1 and up-regulate the expression of Kir2.1 protein in vivo and in vitro. However, the mechanism between AE and miR-1 is unclear and needs further investigation. Lin et al. found that AE inhibited the invasion of nasopharyngeal carcinoma cells by suppressing the expression of MMP-2 via the p38 MAPK-NF-kappaB signaling pathway [42]. In future work, we will propose potential mechanisms between Aloe-emodin and miR-1 expression from the perspective of the p38 MAPK signal pathway. We also hypothesize that the SRF, a transcriptional activator of the miR-1 gene was involved in the signal pathway. It should be noted that although AE significantly repressed miR-1expression in HFD rats, other miRNAs could not be excluded in the pharmacological effect of AE.

Although we confirmed AE effects on high-fat diet induced QT prolongation, limitations still remain in this study, such as effects of AE on IKr/hERG. Because IKr current is difficult to capture in Wistar rats, we did not examine the change of IKr/hERG in this study. Thus, the contribution of IKr in HFD-induced QT prolongation should be considered when interpreting our results. Further studies are needed to examine the alteration of IKr in cardiomyocytes of guinea pigs. In conclusion, the present study provides insights into the new pharmacological role of AE against HFD-induced QT prolongation.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (81603263), the Finance Research Project of Heilongjiang Province (201625).

Disclosure Statement

The authors declare no competing financial interests.


References

  1. Klop B, Elte JW, Cabezas MC: Dyslipidemia in obesity: mechanisms and potential targets. Nutrients 2013; 5: 1218-1240.
  2. Swier VJ, Tang L, Radwan MM, Hunter WJ, 3rd, Agrawal DK: The role of high cholesterol-high fructose diet on coronary arteriosclerosis. Histol Histopathol 2016; 31: 167-176.
  3. Sato Mito N, Suzui M, Yoshino H, Kaburagi T, Sato K: Long term effects of high fat and sucrose diets on obesity and lymphocyte proliferation in mice. J Nutr Health Aging 2009; 13: 602-606.
  4. Liu YB, Wu CC, Lu LS, Su MJ, Lin CW, Lin SF, Chen LS, Fishbein MC, Chen PS, Lee YT: Sympathetic nerve sprouting, electrical remodeling, and increased vulnerability to ventricular fibrillation in hypercholesterolemic rabbits. Circ Res 2003; 92: 1145-1152.
  5. Szabo Z, Harangi M, Lorincz I, Seres I, Katona E, Karanyi Z, Paragh G: Effect of hyperlipidemia on QT dispersion in patients without ischemic heart disease. Can J Cardiol 2005; 21: 847-850.
  6. Watanabe H, Tanabe N, Watanabe T, Darbar D, Roden DM, Sasaki S, Aizawa Y: Metabolic syndrome and risk of development of atrial fibrillation: the Niigata preventive medicine study. Circulation 2008; 117: 1255-1260.
  7. Zhang Y, Wei L, Sun D, Cao F, Gao H, Zhao L, Du J, Li Y, Wang H: Tanshinone IIA pretreatment protects myocardium against ischaemia/reperfusion injury through the phosphatidylinositol 3-kinase/Akt-dependent pathway in diabetic rats. Diabetes Obes Metab 2010; 12: 316-322.
  8. Li K, Yao W, Zheng X, Liao K: Berberine promotes the development of atherosclerosis and foam cell formation by inducing scavenger receptor A expression in macrophage. Cell Res 2009; 19: 1006-1017.
  9. Jin W, Wang YF, Ge RL, Shi HM, Jia CQ, Tu PF: Simultaneous analysis of multiple bioactive constituents in Rheum tanguticum Maxim. ex Balf. by high-performance liquid chromatography coupled to tandem mass spectrometry. Rapid Commun Mass Spectrom 2007; 21: 2351-2360.
  10. Feng Y, Huang SL, Dou W, Zhang S, Chen JH, Shen Y, Shen JH, Leng Y: Emodin, a natural product, selectively inhibits 11beta-hydroxysteroid dehydrogenase type 1 and ameliorates metabolic disorder in diet-induced obese mice. Br J Pharmacol 2010; 161: 113-126.
  11. Wang J, Ji J, Song Z, Zhang W, He X, Li F, Zhang C, Guo C, Wang C, Yuan C: Hypocholesterolemic effect of emodin by simultaneous determination of and bile salts binding. Fitoterapia 2016; 110: 116-122.
  12. Thimmegowda NR, Park C, Shwetha B, Sakchaisri K, Liu K, Hwang J, Lee S, Jeong SJ, Soung NK, Jang JH, Ryoo IJ, Ahn JS, Erikson RL, Kim BY: Synthesis and antitumor activity of natural compound aloe emodin derivatives. Chem Biol Drug Des 2015; 85: 638-644.
  13. Hu B, Zhang H, Meng X, Wang F, Wang P: Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. J Ethnopharmacol 2014; 153: 846-853.
  14. Tabolacci C, Cordella M, Turcano L, Rossi S, Lentini A, Mariotti S, Nisini R, Sette G, Eramo A, Piredda L, De Maria R, Facchiano F, Beninati S: Aloe-emodin exerts a potent anticancer and immunomodulatory activity on BRAF-mutated human melanoma cells. Eur J Pharmacol 2015; 762: 283-292.
  15. Krol J, Loedige I, Filipowicz W: The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet 2010; 11: 597-610.
  16. Schulte C, Karakas M, Zeller T: microRNAs in cardiovascular disease - clinical application. Clin Chem Lab Med 2016; 10.1515/cclm-2016-0576
  17. Ambros V: The functions of animal microRNAs. Nature 2004; 431: 350-355.
  18. Liao C, Gui Y, Guo Y, Xu D: The regulatory function of microRNA-1 in arrhythmias. Mol Biosyst 2016; 12: 328-333.
  19. Zhang Y, Sun L, Zhang Y, Liang H, Li X, Cai R, Wang L, Du W, Zhang R, Li J, Wang Z, Ma N, Wang X, Du Z, Yang B, Gao X, Shan H: Overexpression of microRNA-1 causes atrioventricular block in rodents. Int J Biol Sci 2013; 9: 455-462.
  20. Jia X, Zheng S, Xie X, Zhang Y, Wang W, Wang Z, Zhang Y, Wang J, Gao M, Hou Y: MicroRNA-1 accelerates the shortening of atrial effective refractory period by regulating KCNE1 and KCNB2 expression: an atrial tachypacing rabbit model. PLoS One 2013; 8:e85639.
  21. Ai J, Zhang R, Gao X, Niu HF, Wang N, Xu Y, Li Y, Ma N, Sun LH, Pan ZW, Li WM, Yang BF: Overexpression of microRNA-1 impairs cardiac contractile function by damaging sarcomere assembly. Cardiovasc Res 2012; 95: 385-393.
  22. Alves HN, da Silva AL, Olsson IA, Orden JM, Antunes LM: Anesthesia with intraperitoneal propofol, medetomidine, and fentanyl in rats. J Am Assoc Lab Anim Sci 2010; 49: 454-459.
  23. Kmecova J, Klimas J: Heart rate correction of the QT duration in rats. Eur J Pharmacol 2010; 641: 187-192.
  24. Chen X, Shan H, Zhao J, Hong Y, Bai Y, Sun I, Pan Z, Zhang Y, Yang B, Du Z: L-type calcium current (ICa,L) and inward rectifier potassium current (IK1) are involved in QT prolongation induced by arsenic trioxide in rat. Cell Physiol Biochem 2010; 26: 967-974.
  25. Dong DL, Chen C, Huo R, Wang N, Li Z, Tu YJ, Hu JT, Chu X, Huang W, Yang BF: Reciprocal repression between microRNA-133 and calcineurin regulates cardiac hypertrophy: a novel mechanism for progressive cardiac hypertrophy. Hypertension 2010; 55: 946-952.
  26. Sah R, Ramirez RJ, Oudit GY, Gidrewicz D, Trivieri MG, Zobel C, Backx PH: Regulation of cardiac excitation-contraction coupling by action potential repolarization: role of the transient outward potassium current (I(to)). J Physiol 2003; 546: 5-18.
  27. Wu Z, Chen Q, Ke D, Li G, Deng W: Emodin protects against diabetic cardiomyopathy by regulating the AKT/ GSK-3beta signaling pathway in the rat model. Molecules 2014; 19: 14782-14793.
  28. Wu Y, Tu X, Lin G, Xia H, Huang H, Wan J, Cheng Z, Liu M, Chen G, Zhang H, Fu J, Liu Q, Liu DX: Emodin-mediated protection from acute myocardial infarction via inhibition of inflammation and apoptosis in local ischemic myocardium. Life Sci 2007; 81: 1332-1338.
  29. Zhao XY, Qiao GF, Li BX, Chai LM, Li Z, Lu YJ, Yang BF: Hypoglycaemic and hypolipidaemic effects of emodin and its effect on L-type calcium channels in dyslipidaemic-diabetic rats. Clin Exp Pharmacol Physiol 2009; 36: 29-34.
  30. Liu J, Wang P, Zou L, Qu J, Litovsky S, Umeda P, Zhou L, Chatham J, Marsh SA, Dell’Italia LJ, Lloyd SG: High-fat, low-carbohydrate diet promotes arrhythmic death and increases myocardial ischemia-reperfusion injury in rats. Am J Physiol Heart Circ Physiol 2014; 307:H598-608.

1. Sumsakul W, Plengsuriyakarn T, Chaijaroenkul W, Viyanant V, Karbwang J, Na-Bangchang K. Antimalarial activity of plumbagin in vitro and in animal models. BMC Complement Altern Med. 2014;14(15):1–6.[PMC free article][PubMed]

2. World Health Organization. World Malaria Report Available: http://www.who.int/malaria/world_malaria_report_2010/worldmalariareport2010.pdf. 2010; Accessed 6 Dec 2011.

3. Das A, Anvikar AR, Cator LJ, Dhiman RC, Eapen A, Mishra N, Nagpal BN, Nanda N, Raghavendra K, Read AF, Sharma SK. Malaria in India: the center for the study of complex malaria in India. Acta Trop. 2012;121(3):267–273. doi: 10.1016/j.actatropica.2011.11.008.[PMC free article][PubMed][Cross Ref]

4. Jensen M, Mehlhorn H. Seventy-five years of Resochin® in the fight against malaria. Parasitol Res. 2009;105(3):609–627. doi: 10.1007/s00436-009-1524-8.[PubMed][Cross Ref]

5. World Malaria Report, World Health Organization, Geneva, Switzerland; 2016 p. 57.

6. Kone AK, Sagara I, Thera MA, Dicko A, Guindo A, Diakite S, Kurantsin-Mills J, Djimde A, Walcourt A, Doumbo O. Plasmodium falciparum clearance with artemisinin-based combination therapy (ACT) in patients with glucose-6-phosphate dehydrogenase deficiency in Mali. Malar J. 2010;9(1):332. doi: 10.1186/1475-2875-9-332.[PMC free article][PubMed][Cross Ref]

7. Modrzynska KK, Creasey A, Loewe L, Cezard T, Borges ST, Martinelli A, Rodrigues L, Cravo P, Blaxter M, Carter R, Hunt P. Quantitative genome re-sequencing defines multiple mutations conferring chloroquine resistance in rodent malaria. BMC Genomics. 2012;13(1):106. doi: 10.1186/1471-2164-13-106.[PMC free article][PubMed][Cross Ref]

8. World Malaria Report . World health organization. Geneva: Switzerland; 2010.

9. Maguire JD, Sumawinata IW, Masbar S, Laksana B, Prodjodipuro P, Sismadi P, Mahmud N, Bangs MJ, Baird JK, Susanti I. Chloroquine-resistant Plasmodium malariae in south Sumatra. Indonesia The Lancet. 2002;360(9326):58–60. doi: 10.1016/S0140-6736(02)09336-4.[PubMed][Cross Ref]

10. Nwaka S. Drug discovery and beyond: the role of public-private partnerships in improving access to new malaria medicines. Trans R Soc Trop Med and Hyg. 2005;99(Suppl 1):20–29. doi: 10.1016/j.trstmh.2005.06.003.[PubMed][Cross Ref]

11. Jacob EJ. Natural products-based drug discovery: some bottlenecks and considerations. Curr Sci. 2009;96(6):753–754.

12. Robert A, Benoit-Vical F, Dechy-Cabaret O, Meunier B. From classical antimalarial drugs to new compounds based on the mechanism of action of artemisinin. Pure Appl Chem. 2001;73(7):1173–1188. doi: 10.1351/pac200173071173.[Cross Ref]

13. Muthaura CN, Keriko JM, Derese S, Yenesew A, Rukunga GM. Investigation of some medicinal plants traditionally used for treatment of malaria in Kenya as potential sources of antimalarial drugs. Exp Parasitol. 2011;127(3):609–626. doi: 10.1016/j.exppara.2010.11.004.[PubMed][Cross Ref]

14. Pillay P, Maharaj VJ, Smith PJ. Investigating south African plants as a source of new antimalarial drugs. J Ethnopharmacol. 2008;119(3):438–454. doi: 10.1016/j.jep.2008.07.003.[PubMed][Cross Ref]

15. Krishnarajua AV, Rao TVN, Sundararajua D, Vanisreeb M, Tsayb H, Subbaraju GV. Assessment of bioactivity of India medicinal plants using brine shrimp (Artemia salina) lethality assay. Int J Appl Sci Eng. 2005;3(2):125–134.

16. Choudhary N, Sekhon BS. An overview of advances in the standardization of herbal drugs. J Pharm Educ Res. 2011;2(2):55.

17. Jain A, Lodhi S, Singhai AK. Simultaneous estimation of quercetin and rutin in Tephrosia purpurea Pers by high performance thin layer chromatography. Asian J Tradit Med. 2009;4(3):104–109.

18. Eggli U. Illustrated handbook of succulent plants. Monocotyledons: Springer; 2001.

19. Eshun K, Qian H. Aloe vera: a valuable ingredient for the food, pharmaceutical and cosmetic industries-a review. Crit Rev Food Sci Nutr. 2004;44:91–96. doi: 10.1080/10408690490424694.[PubMed][Cross Ref]

20. Boudreau MD, Beland FA. An evaluation of the biological and toxicological properties of Aloe barba- densis (miller), Aloe vera. J Environ Sci Health part C. 2006;24(1):103–154. doi: 10.1080/10590500600614303.[PubMed][Cross Ref]

21. Rishi P, Rampuria A, Tewari R, Koul A. Phyto- modulatory potentials of Aloe vera against Salmonella OmpR-mediated inflammation. Phytother Res. 2008;22(8):1075–1082. doi: 10.1002/ptr.2458.[PubMed][Cross Ref]

22. Wintola OA, Afolayan AJ. Phytochemical constituents and antioxidant activities of the whole leaf extract of Aloe ferox mill. Pharmaco Mag. 2011;7(28):325–333. doi: 10.4103/0973-1296.90414.[PMC free article][PubMed][Cross Ref]

23. Langmead L, Makins RJ, Rampton DS. Anti-inflammatory effects of Aloe vera gel in human colorectal mucosa in vitro. Aliment Pharmacol Therap. 2004;19:521–527. doi: 10.1111/j.1365-2036.2004.01874.x.[PubMed][Cross Ref]

24. Jayaprakasha GK, Singh RP, Sakariah KK. Antioxidant activity of grape seed (Vitis vinifera) extracts on peroxidation models in vitro. Food Chem. 2001;73:285–290. doi: 10.1016/S0308-8146(00)00298-3.[Cross Ref]

25. Ali AA, Al-Rahwi K, Lindequist U. Some medicinal plants used in Yemeni herbal medicine to treat malaria. Afr J Trad CAM. 2004;1:72–76.

26. Asiimwe S, Namutebi A, Borg-Karlson AK, Mugisha MK, Kakudidi EK, Hannington OO. Documentation and consensus of indigenous knowledge on medicinal plants used by the local communities of western Uganda. J Nat Prod Plant Resour. 2014;4(1):34–42.

27. Van Zyl RL, Viljoen AM. In vitro activity of aloe extracts against Plasmodium falciparum. S Afr J Bot. 2002;68:106–110. doi: 10.1016/S0254-6299(16)30465-3.[Cross Ref]

28. Neuwinger HD. African Ethnobotany. Poisons and Drugs; London: Chapman & Hall; 1996. p. 3–9.

29. Surjushe A, Vasani R, Saple DG. Aloe Vera: a short review. Indian J Dermatol. 2008;53(4):163–166. doi: 10.4103/0019-5154.44785.[PMC free article][PubMed][Cross Ref]

30. Venkatesalu V, Gopalan N, Pillai CR, Singh V, Chandrasekaran M, Senthilkumar A, Chandramouli N. In vitro antiplasmodial activity of some traditionally used medicinal plants against Plasmodium falciparum. Parasitol Res 2012;111(1):497–501. [PubMed]

31. Trager W, Jensen JB. Human malaria parasites in continuous culture. Science. 1976;193(4254):673–675. doi: 10.1126/science.781840.[PubMed][Cross Ref]

32. World Health Organization. In vitro micro test (Mark III) for the assessment of the response of Plasmodium falciparum to chloroquine, mefloquine, quinine, amodiaquine, sulfadoxine/pyrimethamine and artemisinin. WHO, Geneva. 2001.

33. World Malaria Report, World Health Organization, Geneva, Switzerland, 2014.

34. Joshi H, Prajapati SK, Verma A, Kang’a S, Carlton JM. Plasmodium vivax in India. Trends Parasitol. 2008;24(5):228–235. doi: 10.1016/j.pt.2008.01.007.[PubMed][Cross Ref]

35. Dash AP, Adak T, Raghavendra K, Singh OP. The biology and control of malaria vectors in India. Currnt Sci. 2007;92:1571–1578.

36. Singh V, Mishra N, Awasthi G, Dash AP, Das A. Why is it important to study malaria epidemiology in India? Trends Parasitol. 2009;25(10):452–457. doi: 10.1016/j.pt.2009.06.004.[PubMed][Cross Ref]

37. Kumar S, Yadav M, Yadav A, Yadav JP. Comparative analysis of antimicrobial activity of methanolic extracts of Aloe vera and quantification of aloe- emodin collected from different climatic zones of India. Arch Clin Microb. 2015;6(2):1–10.

38. Wilikie SE, Issac PG, Slater RJ. Random amplified polymorphic DNA (RAPD) markers for genetic analysis in Allium. Theor Appl Genet. 1993;87:668–672.

39. Iqbal S, Bhanger MI. Effect of season and production location on antioxidant activity of Moringa oleifera leaves grown in Pakistan. J Food Comp Anal. 2006;19:544–551. doi: 10.1016/j.jfca.2005.05.001.[Cross Ref]

40. Thu K, Mon YY, Khaing TA, Tun OM. Study on phytochemical properties, antibacterial activity and cytotoxicity of Aloe vera L. World Acad Sci Eng Technol. 2013;77:102–106.

41. Kumar S, Yadav JP. Ethnobotanical and pharmacological properties of Aloe vera: a review. J Med Plants Res. 2014;48(8):1387–1398.

42. Yan L. The health efficacy of aloe and its development and utilization. Asian Soc Sci. 2009;5(9):151–154.

43. Sittie AA, Lemmich E, Olsen CE, Hviid L, Kharazmi A, Nkrumah FK, Christensen SB. Structure-activity studies: in vitro antileishmanial and antimalarial activities of anthraquinones from Morinda lucida. Planta Med. 1999;65(3):259–261. doi: 10.1055/s-2006-960473.[PubMed][Cross Ref]

44. Li-chuan WA. Research advance on the main chemical components of aloes leaf and their efficacies. Anim Husbandry Feed Sci. 2009;30(1):25–26.

45. Ellof JN. Which extractant should be used for the screening and isolation of antimicrobial components from plants? J Ethnopharmacol. 1998;60:1–8. doi: 10.1016/S0378-8741(97)00123-2.[PubMed][Cross Ref]

46. Adesanya SA. From nature to drugs. Theories and realities. Inaugural lecture series. Ile-Ife, Osun State Nigeria: Obafemi Awolowo University Press Ltd. 2005:181.

47. Parekh J, Jadeja D, Chanda S. Efficacy of aqueous and methanol extracts of some medicinal plants for potential antibacterial activity. Turk J Biol. 2005;29:203–221.

48. Leira HL, Fonnum F, Syversen T. Organic solvents. In: Ballatyne, Marrs, Syversen. editors. General and Applied Toxicology, 3rd edition. London: Wiley. 2009:3285–308.

49. Sonawane SD, Nirmal SA, Patil AN, Pattan SR. Development and validation of HPTLC method to detect curcumin and gallic acid in polyherbal formulation. J Liq Chrom Relat Tech. 2011;34(20):2664–2673. doi: 10.1080/10826076.2011.593221.[Cross Ref]

50. Reich E, Schibli A. High performance thin layer chromatography for the analysis of medicinal plants. New York: Thieme; 2007. pp. 130–162.

51. Suga T, Hirata T. The efficacy of the aloe plants chemical-constituents and biological-activities. Cosmet Toiletries. 1983;98(6):105–108.

52. Van Wyk BE, Yenesew A, Dagne E. Chemotaxonomic significance of anthraquinones in the roots of Asphodeloideae (Asphodelaceae) Biochem Syst Ecol. 1995;23(3):277–281. doi: 10.1016/0305-1978(94)00094-W.[Cross Ref]

53. Dagne E, Bisrat D, Viljoen A, Van Wyk BE. Chemistry of Aloe species. Curr Org Chem. 2000;4:1055–1078. doi: 10.2174/1385272003375932.[Cross Ref]

54. Nyiligira E, Viljoen AM, Van Heerden FR, Van Zyl RL, Van Vuuren SF, Steenkamp PA. Phytochemistry and in vitro pharmacological activities of south African Vitex (Verbenaceae) species. J Ethnopharmacol. 2008;119(3):680–685. doi: 10.1016/j.jep.2008.07.004.[PubMed][Cross Ref]

55. Clarkson C, Maharaj VJ, Crouch NR, Grace OM, Pillay P, Matsabisa MG, et al. In vitro antiplasmodial activity of medicinal plants native to or naturalised in South Africa. J Ethnopharmacol. 2004;92(2):177–191. doi: 10.1016/j.jep.2004.02.011.[PubMed][Cross Ref]

56. Matasyoh JC, Wathuta EM, Kariuki ST, Chepkorir R, Kavulani J. Aloe plant extracts as alternative larvicides for mosquito control. Afr J Biotechnol. 2008;7(7):912–915.

57. Osman CP, Ismail NH, Ahmad R, Ahmat N, Awang K, Jaafar FM. Anthraquinones with antiplasmodial activity from the roots of Rennellia elliptica Korth.(Rubiaceae)Molecules. 2010;15(10):7218–7226. doi: 10.3390/molecules15107218.[PubMed][Cross Ref]

58. El Heiga LA, Katzhendler J, Gean KF, Bachrach U. Antimalarial activity of substituted anthraquinones. Biochem Pharmacol. 1990;39

Comments

Leave a Reply

Your email address will not be published. Required fields are marked *